Macropharyngodon meleagris | University of the Philippines Mindanao | Marine Biodiversity Database Project
Macropharyngodon meleagris
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Macropharyngodon
  • Species » meleagris
  • Macropharyngodon meleagris
    (Blackspotted wrasse)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 60 m , usually 0 - 30 m . Tropical; 24°C - 28°C ; 30°N - 30°S, 94°E - 124°W

    Maturity: Lm ?  range ? - ? cm Max length : 15.0 cm SL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 11; Anal spines: 3; Anal soft rays: 11; Vertebrae: 25. Color in life of young and females whitish to greenish with irregular black spots; males orange-red with greenish yellow spots (edged in blue and black, per scale); head spotted and banded. Anterior lateral line scales with 2-4 pores. Pelvic fins short, not reaching anus. Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_ND_005A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:23 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524483
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:37 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATAGTGGGCACGGCCCTAAGCTTGCTCATCCGAGCCGAACTTAGCCAGCCCGGTGCTCTCCTCGGAGATGACCAGATCTACAACGTTATCGTAACAGCCCATGCTTTCGTAATGATCTTCTTTATAGTAATACCCATTATGATTGGCGGGTTTGGGAACTGACTAATTCCATTAATGATCGGGGCCCCTGACATGGCCTTTCCCCGAATAAACAACATGAGCTTTTGACTTCTGCCCCCCTCCTTCCTCCTCCTCCTGGCCTCATCAGGCGTAGAGGCCGGGGCAGGAACTGGCTGAACAGTATACCCCCCTTTAGCAGGAAACCTCGCCCATGCAGGAGCATCCGTGGACCTAACTATCTTTTCGCTGCACTTAGCTGGTATCTCTTCTATTTTAGGCGCAATTAACTTTATTACAACCATTGTTAACATAAAACCCCCAGCCATTTCACAGTATCAGACACCTCTATTCGTCTGAGCCGTTTTAATTACAGCAGTCCTGCTACTCCTGTCCCTCCCAGTCCTAGCTGCCGGCATCACCATGCTTCTAACTGACCGAAACCTAAATACTACGTTCTTTGACCCCGCCGGAGGGGGAGACCCAATTTTATACCAACACTTATTCTGA