Cheilinus undulatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cheilinus undulatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Cheilinus
  • Species » undulatus
  • Cheilinus undulatus
    (Humphead wrasse)
  • Description »  

    Marine; reef-associated; depth range 0 - 100 m . Tropical; 30°N - 23°S

    Maturity: Lm ?, range 52 - ? cm Max length : 229 cm SL male/unsexed; ; common length : 60.0 cm TL male/unsexed; ; max. published weight: 191.0 kg ; max. reported age: 32 years

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body deep, its depth 2.2-2.7 times in standard length; dorsal profile of head straight to above eye, then becoming convex; adults develop a large hump on forehead that can protrude anterior to eye; anterior tip of head forming an acute angle; jaws and lips prominent, 2 strong canines anteriorly in each jaw; no enlarged tooth present of rear of upper jaw; D IX,10, continuous; A III,8; dorsal and anal fins of adults very pointed, reaching well posterior to caudal-fin base; pelvic fins of small fish reaching anus, extending beyond anal-fin origin in large adults; pectoral fins with ii unbranched and 10 branched rays; caudal fin rounded; lateral line interrupted below posterior portion of dorsal-fin base, with a total of 22-23 pored scales; scales reaching well onto bases of dorsal and anal fins; scales in front of dorsal fin extending forward to above centre of eye; cheek and opercle scaly; lower jaw without scales. Colour of body olive to green with a vertical dark bar on each scale above and behind pectoral fins; head of adults blue-green to blue with highly irregular undulating yellowish lines; 2 black lines extending posteriorly from eye. Juvenile coloration lighter to white with dark scale bars and prominent black lines extending posteriorly from eyes, as well as 2 lines extending diagonally up and back from eye and 2 diagonally downward on snout in front of eye . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2018_NN_002A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Endangered (EN)(A2bd+3bd); Date assessed:30 April 2004 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524330
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:32 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTACCTTGTATTCGGTGCCTGAGCCGGCATAGTAGGCACTGCCCTAAGCCTGCTTATCCGGGCAGAACTTAGCCAGCCAGGTGCTCTTCTCGGAGACGATCAGATTTACAATGTCATCGTTACGGCCCACGCCTTCGTTATAATCTTCTTTATAGTAATACCAATCATGATCGGTGGCTTCGGAAACTGGCTAATCCCCCTTATGATCGGTGCCCCAGACATAGCCTTCCCCCGAATGAATAACATGAGTTTCTGACTCCTACCTCCTTCCTTCCTGCTTCTCCTTGCCTCCTCTGGTGTGGAAGCGGGAGCTGGGACCGGTTGGACAGTCTACCCTCCGCTAGCTGGAAACTTAGCTCACGCAGGCGCGTCTGTAGATCTCACAATCTTTTCCCTTCATCTAGCCGGGATCTCTTCCATCCTAGGAGCCATCAACTTTATTACAACTATTATTAACATGAAACCTCCAGCTATTACTCAATACCAAACACCTCTATTCGTGTGGGCCGTCCTAATTACAGCAGTTTTACTTCTTCTCTCCCTTCCTGTGCTCGCCGCCGGCATTACAATACTTTTAACAGACCGAAATCTAAACACCACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATCCTCTACCAACACTTATTTTGA