Epinephelus coeruleopunctatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus coeruleopunctatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » coeruleopunctatus
  • Epinephelus coeruleopunctatus
    (Whitespotted grouper)
  • Description »  

    Marine; reef-associated; depth range 2 - 65 m . Tropical; 35°N - 35°S, 26°E - 180°E

    Maturity: Lm ?, range 42 - ? cm Max length : 76.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body depth distinctly less than head length, 2.9-3.4 in SL (for specimens 11-47 cm SL); head length 2.3-2.5 in SL; head pointed, dorsal profile almost straight; preopercle rounded, finely serrate; opercular spines inconspicuous; upper edge of operculum straight, sinuous or slightly convex; maxilla naked, mostly covered by upper lip; small or absent canines at front of jaws; midlateral part of lower jaw with 3-5 rows of small teeth; gill rakers of first gill arch 8-10 + 13-17 in juveniles and 4-8 in upper limb for adults larger than 25 cm SL; adults with ctenoid scales on body in broad zone along middle of side, cycloid elsewhere and with numerous auxiliary scales; caudal fin rounded; pectoral fins large and fleshy, with 17-19 rays, the fin length 1.5-2.1 in HL; short pelvic fins, not reaching anus, 2.0-2.7 in head length. Colour of adults brownish grey, the body covered with small pale spots overlain with large pale blotches; oblique black saddle on rear half of peduncle; 4-5 indistinct black blotches at base of dorsal fin; prominent black streak on maxillary groove; large adults brownish, covered with small, indistinct, contiguous pale spots; juveniles (less than 25 cm) dark grey to black, covered with prominent pupil-size white spots and smaller white dots ( Ref. 39231, 89707, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2018_NN_001A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:16 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524381
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:28 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGTATGGTAGGAACAGCCCTCAGCCTGCTTATTCGAGCCGAGCTTAGCCAACCAGGGGCTCTACTGGGTGACGACCAGATCTATAATGTGATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTCATCCCACTAATAATTGGTGCTCCAGACATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTTCTCCCCCCATCCTTCCTGCTTCTTCTCGCTTCTTCTGGGGTAGAAGCCGGTGCTGGTACTGGCTGAACAGTTTATCCACCCCTAGCCGGAAACCTAGCCCATGCAGGTGCATCTGTAGACTTAACTATCTTTTCACTACATCTAGCAGGGATCTCATCAATTTTAGGTGCAATCAATTTTATTACAACCATTATTAACATAAAACCCCCAGCCATCTCCCAATACCAAACACCTTTATTTGTATGAGCAGTGTTAATTACAGCGGTGCTTCTGCTCCTCTCTCTTCCTGTTCTTGCCGCCGGTATTACAATGCTACTCACAGATCGCAATCTTAACACCACTTTCTTCGACCCAGCCGGAGGGGGAGACCCCATTCTTTACCAACACTTATTTTGA