Bodianus dictynna | University of the Philippines Mindanao | Marine Biodiversity Database Project
Bodianus dictynna
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Bodianus
  • Species » dictynna
  • Bodianus dictynna
    (Redfin hogfish)
  • Description »   (Wikipedia) Bodianus dictynna, is a species of wrasse native to tropical and warm temperate waters of the Western Pacific, from the Indo-Malaysian Archipelago east to Tonga, as far north as Japan and as far south as Australia. It is most frequently recorded in association with living coral reefs and the juvenile fish usually occur near black coral and gorgonians, although they sometimes are found in caves near the ceiling. It feeds mainly on benthic invertebrates such as molluscs and crustaceans. The juveniles regularly behave as cleaner fish, removing parasites from other fish. The specific name dictynna is an alternative name for Diana, the Roman goddess of hunting, and refers to the close relationship between this species and Bodianus diana of the Indian Ocean, and a proposed common name of Pacific Diana's pigfish also reflects this relationship.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_103A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524262
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:13 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATGGTCGGTACCGCGCTAAGTTTACTTATCCGGGCCGAACTAAGCCAACCGGGCGCTCTTCTTGGAGACGACCAAATTTACAATGTCATTGTTACGGCGCATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGGAACTGACTTATTCCGCTGATGATCGGAGCACCCGATATGGCCTTCCCTCGCATGAATAACATAAGCTTCTGGCTTCTCCCCCCATCCTTCCTCCTTCTCCTAGCGTCTTCTGGCGTAGAGGCTGGAGCCGGAACTGGGTGAACTGTCTACCCCCCACTAGCGGGCAATCTCGCCCACGCGGGAGCATCAGTCGACCTCACCATCTTCTCTCTCCACCTGGCGGGGGTCTCATCAATCCTAGGGGCAATCAATTTTATCACAACCATTATTAACATGAAACCGCCAGCCATCTCTCAGTATCAGACCCCCTTATTCGTTTGAGCCGTGCTTATTACAGCTGTGCTCCTTCTGCTCTCCCTACCAGTCCTTGCCGCCGGAATTACAATGCTCCTGACGGACCGAAACCTAAATACGACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATCCTGTACCAGCACCTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 300 visit(s) today - 303786 total visits (551 average daily visits): 2023-05-22 - 2024-11-23 (551 days)