Sphaeramia nematoptera | University of the Philippines Mindanao | Marine Biodiversity Database Project
Sphaeramia nematoptera
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Kurtiformes
  • Family » Apogonidae
  • Genus » Sphaeramia
  • Species » nematoptera
  • Sphaeramia nematoptera
    (Pajama cardinalfish)
  • Description »   (Wikipedia) The pajama cardinalfish, spotted cardinalfish, coral cardinalfish, or polkadot cardinalfish (Sphaeramia nematoptera) is a species of fish belonging to the family Apogonidae. It is a popular aquarium fish. It grows to a total length around 8.5 cm (3.3 in) and features distinctive red eyes and a broad, dark, vertical 'waistband' with scattered red spots toward the tail. It is considered to be of low vulnerability, and is distributed throughout much of the western Pacific Ocean, from Java to Fiji, and from the Ryukyu Islands south to the Great Barrier Reef. The male pajama cardinalfish incubates the eggs in his mouth until they hatch.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_100A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524684
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:07 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAGTATTTGGTGCTTGGGCCGGGATAGTCGGAACAGCCCTTAGCCTGCTCATTCGAGCGGAGCTAAGCCAGCCTGGGGCCCTTCTCGGCGACGACCAGATTTACAACGTAATCGTAACAGCACATGCATTTGTTATAATCTTCTTTATAGTAATGCCAATTATGATTGGGGGCTTTGGGAACTGACTAATTCCACTAATAATCGGTGCCCCCGATATGGCATTCCCCCGAATAAATAACATGAGCTTCTGACTCCTTCCACCCTCATTTCTCCTCCTCCTTGCCTCCTCAGGGGTAGAAGCTGGGGCCGGGACCGGGTGAACCGTTTACCCGCCTCTCGCGGGCAATCTTGCACACGCGGGGGCTTCCGTTGACCTAACAATTTTCTCCCTGCACCTCGCAGGTATCTCATCAATTCTGGGAGCCATCAACTTCATTACCACAATTATTAATATGAAACCCCCTGCAATCACTCAGTATCAAACTCCTCTATTTGTGTGAGCAGTCCTTATTACTGCTGTCCTCCTTCTTCTCTCCCTCCCTGTTCTAGCTGCTGGTATCACCATGCTACTGACAGACCGGAACTTAAACACAACCTTCTTCGACCCGGCCGGAGGAGGAGACCCAATCCTCTACCAACACCTGTTTTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 415 visit(s) today - 171479 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)