Coryphaena hippurus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Coryphaena hippurus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Coryphaenidae
  • Genus » Coryphaena
  • Species » hippurus
  • Coryphaena hippurus
    (Common dolphinfish)
  • Description »   (Wikipedia) The mahi-mahi (/ˈmɑːhiːˈmɑːhiː/) or common dolphinfish (Coryphaena hippurus) is a surface-dwelling ray-finned fish found in off-shore temperate, tropical, and subtropical waters worldwide. It is also widely called dorado (not to be confused with Salminus brasiliensis, a freshwater fish) and dolphin (not to be confused with the aquatic mammal dolphin). It is one of two members of the family Coryphaenidae, the other being the pompano dolphinfish. These fish are most commonly found in the waters around the Gulf of Mexico, Costa Rica, Hawaii and the Indian Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1910_STAM_028A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2010 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524351
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:07 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAATTTTCGGTGTCTTAGCAGGGATAACAGGAACAGGTTTAAGTCTTCTCATTCGAGCTGAGTTAAGCCAGCCTGGGTCACTTCTAGGAGATGACCAAACCTATAATGTCATCGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTTATGCCAATTATGATCGGAGGCTTCGGGAACTGATTAATCCCACTAATGCTTGGCGCTCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTTCTTCCACCATCATTTCTTCTCCTTCTAGCCTCTTCAGGGGTAGAAGCAGGAGCAGGAACTGGTTGAACGGTCTACCCACCTCTGGCGGGTAACTTAGCCCATGCTGGGGCCTCTGTAGATTTAACAATTTTCTCCCTGCATTTAGCCGGGGTATCATCAATTCTTGGGGCAATCAATTTTATTACAACTATTATTAATATAAAACCCCCCACAGTAACGATATACCAAATTCCACTATTCGTGTGAGCTGTACTAATTACAGCTGTACTACTACTCCTATCACTTCCTGTCCTAGCTGCGGGAATTACAATACTGCTAACAGACCGAAATTTAAATACAGCTTTCTTGAACCCAGCGGGAGGAGGGGATCCTATCCTATACCAACACCTG

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1227 visit(s) today - 304713 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)