Coryphaena hippurus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Coryphaena hippurus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Coryphaenidae
  • Genus » Coryphaena
  • Species » hippurus
  • Coryphaena hippurus
    (Common dolphinfish)
  • Description »  

    Marine; brackish; pelagic-neritic; oceanodromous ; depth range 0 - 85 m , usually 5 - 10 m . Subtropical; 21°C - 30°C ; 50°N - 40°S, 180°W - 180°E

    Maturity: Lm 55.8, range 35 - 93.1 cm Max length : 210 cm TL male/unsexed; ; common length : 100.0 cm TL male/unsexed; ; max. published weight: 40.0 kg ; max. reported age: 4 years

    Dorsal spines (total): 0; Dorsal soft rays (total): 58 - 66; Anal spines: 0; Anal soft rays: 25 - 31; Vertebrae: 31. This species is distinguished by having the following characters: mature males with prominent bony crest in front of the head; greatest body depth in adults less than 25% of standard length; tooth patch on tongue small and oval; single dorsal fin extending from above eye almost to caudal fin with 58-66 rays; a concave anal fin extending from anus almost to caudal fin; pectoral fin more than half of head length; lateral-line scales at least 200 . Colour of body metallic blue-green on the back (fading to grey with green tinge when dead), sides silver with golden sheen, and 1 row of dark spots or golden blotches running below dorsal fin and 1, 2, or more rows on and below lateral line, some scattered irregularly; dorsal and anal fins
    black, the latter with a white edge; pectoral fins pale; caudal fin silvery with a golden sheen; in juveniles, only tips of caudal-fin lobes white, pelvic fins black . Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1910_STAM_028A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2010 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524351
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:07 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAATTTTCGGTGTCTTAGCAGGGATAACAGGAACAGGTTTAAGTCTTCTCATTCGAGCTGAGTTAAGCCAGCCTGGGTCACTTCTAGGAGATGACCAAACCTATAATGTCATCGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTTATGCCAATTATGATCGGAGGCTTCGGGAACTGATTAATCCCACTAATGCTTGGCGCTCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTTCTTCCACCATCATTTCTTCTCCTTCTAGCCTCTTCAGGGGTAGAAGCAGGAGCAGGAACTGGTTGAACGGTCTACCCACCTCTGGCGGGTAACTTAGCCCATGCTGGGGCCTCTGTAGATTTAACAATTTTCTCCCTGCATTTAGCCGGGGTATCATCAATTCTTGGGGCAATCAATTTTATTACAACTATTATTAATATAAAACCCCCCACAGTAACGATATACCAAATTCCACTATTCGTGTGAGCTGTACTAATTACAGCTGTACTACTACTCCTATCACTTCCTGTCCTAGCTGCGGGAATTACAATACTGCTAACAGACCGAAATTTAAATACAGCTTTCTTGAACCCAGCGGGAGGAGGGGATCCTATCCTATACCAACACCTG