Scarus hypselopterus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus hypselopterus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » hypselopterus
  • Scarus hypselopterus
    (Yellow-tail parrotfish)
  • Description »   (Wikipedia) Scarus is a genus of parrotfishes. With 52 currently recognised extant species, it is by far the largest parrotfish genus. The vast majority are found at reefs in the Indo-Pacific, but a small number of species are found in the warmer parts of the eastern Pacific and the western Atlantic, with a single species, Scarus hoefleri in the eastern Atlantic. Most are very colourful, and have strikingly different initial (males and females) and terminal (males only) phases. Adults of most species reach maximum lengths of between 30 and 50 cm (12–20 in), but the rainbow parrotfish (Scarus guacamaia) can grow to lengths of 1.2 m (3.9 ft).
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1902_GOVG_022A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Near Threatened (NT); Date assessed:18 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524641
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 10:57 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGAGACGATCAAATTTATAATGTAATCGTCACAGCTCATGCATTTGTAATAATCTTTTTTATAGTCATACCCATCATGATCGGAGGCTTCGGAAATTGACTCATCCCACTTATGATCGGAGCACCCGACATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGACTTCTCCCACCCTCCTTCCTACTATTACTTGCCTCCTCTGGCGTAGAAGCAGGAGCAGGAACCGGATGAACCGTTTACCCACCTCTAGCAGGAAATCTGGCACACGCAGGTGCATCCGTTGATCTAACAATCTTCTCCCTTCACCTGGCAGGAATTTCTTCGATCCTGGGAGCAATCAACTTCATTACAACCATTATTAACATGAAACCGCCTGCCATCTCTCAATACCAAACCCCTCTCTTCGTATGGGCCGTTTTAATTACTGCCGTACTCCTTCTCCTCTCCCTCCCTGTTCTTGCTGCAGGAATTACAATGCTACTGACAGATCGAAACCTAAACACTACTTTCTTTGATCCTGCAGGCGGAGGAGACCCAATTCTCTATCAGCACTTATTCTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 782 visit(s) today - 304268 total visits (552 average daily visits): 2023-05-22 - 2024-11-23 (551 days)