Scarus hypselopterus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus hypselopterus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » hypselopterus
  • Scarus hypselopterus
    (Yellow-tail parrotfish)
  • Description »  

    Marine; reef-associated; depth range 10 - 30 m . Tropical; 30°N - 9°S

    Maturity: Lm ?  range ? - ? cm Max length : 31.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. Males resemble S. bowersi but differs in that the tan area of S. bowersi does not extend as far back as the anal fin . Initial phase has a distinctive black spot at front of the anal fin and yellowish tail and soft dorsal fin. Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1902_GOVG_022A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Near Threatened (NT); Date assessed:18 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524641
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   May 20, 2025, 1:25 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGAGACGATCAAATTTATAATGTAATCGTCACAGCTCATGCATTTGTAATAATCTTTTTTATAGTCATACCCATCATGATCGGAGGCTTCGGAAATTGACTCATCCCACTTATGATCGGAGCACCCGACATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGACTTCTCCCACCCTCCTTCCTACTATTACTTGCCTCCTCTGGCGTAGAAGCAGGAGCAGGAACCGGATGAACCGTTTACCCACCTCTAGCAGGAAATCTGGCACACGCAGGTGCATCCGTTGATCTAACAATCTTCTCCCTTCACCTGGCAGGAATTTCTTCGATCCTGGGAGCAATCAACTTCATTACAACCATTATTAACATGAAACCGCCTGCCATCTCTCAATACCAAACCCCTCTCTTCGTATGGGCCGTTTTAATTACTGCCGTACTCCTTCTCCTCTCCCTCCCTGTTCTTGCTGCAGGAATTACAATGCTACTGACAGATCGAAACCTAAACACTACTTTCTTTGATCCTGCAGGCGGAGGAGACCCAATTCTCTATCAGCACTTATTCTGA