Centropyge bicolor | University of the Philippines Mindanao | Marine Biodiversity Database Project
Centropyge bicolor
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacanthidae
  • Genus » Centropyge
  • Species » bicolor
  • Centropyge bicolor
    (Bicolor angelfish)
  • Description »   (Wikipedia) The bicolor angelfish (Centropyge bicolor) is a marine species of fish, easily recognizable by its yellow tail, yellow front half of their body, and blue rear with blue patterns above and around the eye. Other names of this angelfish include: Pacific rock beauty, oriole angelfish, oriole dwarf angel, blue and gold angel, and two-colored angel. The life expectancy of this fish in the wild varies greatly, depending on location, and ranges between 5 and 13 years. These fish tend to grow to a maximum of 6 inches in length.[citation needed] The larval stages lasts approximately 32 days.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_072A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524288
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:17 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATCTACTATTTGGTGCTTGAGCTGGGATGGTAGGAACCGCTCTAAGCCTACTTATTCGAGCAGAACTCAATCAGCCAGGAAGCCTCCTAGGAGACGACCAGATTTATAATGTAATCGTAACAGCACATGCATTTGTTATAATCTTCTTTATAGTTATACCCGCTATGATTGGAGGATTCGGAAACTGACTGATCCCTCTGATGATCGGAGCCCCCGATATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTCCTCCCCCCTTCCCTTCTGCTTCTCCTCGCTTCTGCAGGTGTAGAAGCTGGGGCCGGAACTGGCTGAACAGTTTATCCCCCTCTAGCCGGCAATCTCGCCCATGCGGGGGCATCCGTGGATCTAACTATTTTTTCCCTTCATCTAGCAGGGATCTCCTCAATTTTAGGAGCTATTAACTTTATTACCACCATCATCAACATAAAACCCCCAGCCATTTCCCAATACCAAACACCACTCTTCGTTTGGGCAGTACTAATTACTGCTGTCCTCCTACTCCTCTCCCTTCCGGTCCTTGCTGCTGGGATTACAATACTCCTTACAGACCGAAATCTAAACACCACCTTCTTTGACCCCGCAGGAGGAGGGGACCCAATTCTCTATCAACACCTATGTTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 547 visit(s) today - 304033 total visits (552 average daily visits): 2023-05-22 - 2024-11-23 (551 days)