Lutjanus fulvus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lutjanus fulvus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Lutjanus
  • Species » fulvus
  • Lutjanus fulvus
    (Blacktail snapper)
  • Description »  

    Marine; freshwater; brackish; reef-associated; depth range 1 - 80 m . Tropical; 20°C - 28°C; 34°N - 34°S, 28°E - 134°W

    Maturity: Lm 20.6  range ? - ? cm Max length : 40.0 cm TL male/unsexed; ; common length : 25.0 cm TL male/unsexed; ; max. published weight: 820.00 g ; max. reported age: 34 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 14; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body with greatest depth 2.3-2.8 in SL; preopercular notch and knob well developed; vomerine tooth patch crescentic, without a medial posterior extension; tongue smooth, without teeth; gill rakers of first gill arch 6-7 + 10-14 = 16-20 (including rudiments); caudal fin slightly emarginate; scale rows on back rising obliquely above lateral line. Colour of back and sides tan, grey to brownish, sides usually with a series of narrow yellow of golden-brown stripes, 1 per scale rows, caudal fin blackish, dorsal and caudal fins with a narrow white border; pectoral, pelvic and anal fins yellowish, and a broad yellow rim around posterior eye ( Ref. 9821, 90102).
    Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_027A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524470
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:14 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTTGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATAATCGGAGCCCCTGATATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTACTTCCCCCATCATTCCTTCTGCTTCTAGCCTCCTCCGGAGTAGAAGCTGGTGCTGGAACTGGGTGAACCGTCTACCCTCCCCTGGCAGGAAACCTCGCACACGCCGGAGCATCCGTTGATCTAACTATTTTCTCTCTACATCTGGCAGGTGTTTCTTCAATTCTAGGGGCTATTAACTTCATTACCACCATCATTAACATGAAACCCCCAGCCATCTCCCAATATCAAACGCCACTATTCGTCTGAGCCGTCCTTATTACCGCTGTCTTACTTCTTCTTTCCCTCCCAGTCCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAATACTACCTTCTTTGATCCTGCAGGAGGAGGAGACCCTATTCTTTACCAGCATCTATTCTGA