Chaetodon lunulatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chaetodon lunulatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Chaetodontidae
  • Genus » Chaetodon
  • Species » lunulatus
  • Chaetodon lunulatus
    (Oval butterflyfish)
  • Description »   (Wikipedia) The oval butterflyfish (Chaetodon lunulatus), red-finned butterflyfish or redfin butterflyfish, is a species of marine ray-finned fish, a butterflyfish belonging to family Chaetodontidae. It is found in the Pacific Ocean from Eastern Indonesia to the Hawaiian islands. This is one species of a closely related group which includes the blacktail butterflyfish, which is found in the Red Sea and Gulf of Aden, and the melon butterflyfish, which is found in the Indian Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_064A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524315
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:18 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGGACCGCCTTAAGCCTGCTCATCCGAGCAGAGCTTAGCCAACCTGGGACACTCCTAGGTGATGACCAGATCTATAATGTAATTGTTACGGCACATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGATTTGGAAACTGACTAATTCCTCTAATAATTGGAGCCCCCGATATGGCTTTCCCTCGAATAAATAATATGAGCTTTTGACTTCTACCCCCCTCCTTCTTCCTACTTCTAGCCTCTTCTGGCGTAGAGTCCGGAGCCGGTACCGGATGGACAGTCTACCCCCCATTAGCTGGAAACCTGGCACACGCCGGAGCATCCGTTGACCTAACCATCTTCTCCCTCCACCTCGCCGGAATCTCCTCTATCCTTGGAGCCATCAATTTTATTACAACAATCCTTAATATAAAACCCCCTGCCATGTCTCAGTATCAGACCCCTCTATTCGTCTGATCTGTTTTAATTACAGCCGTCCTTCTCCTCCTATCCCTTCCTGTCCTTGCAGCCGGAATTACGATACTTCTAACCGACCGAAACTTAAACACAACCTTCTTTGACCCCGCAGGAGGAGGCGATCCAATTCTGTACCAACACCTGTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 599 visit(s) today - 171663 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)