(Scrawled butterflyfish)
Full article at Wikipedia
Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
DNA Sequence »
ATTGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGCACCGCTTTAAGCCTGCTCATCCGAGCAGAGCTTAGCCAGCCTGGCTCACTCTTAGGCGATGACCAGATCTATAACGTAATCGTCACGGCACATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGCAACTGACTGATCCCTCTAATGATTGGGGCCCCCGATATAGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTACCACCCTCCTTCTTCCTGCTTCTCGCCTCTTCCGGTGTAGAATCAGGAGCCGGAACCGGATGGACAGTCTATCCGCCGCTAGCTGGAAACCTAGCACATGCTGGAGCATCCGTTGATTTAACAATCTTCTCCCTTCACCTTGCTGGAATTTCCTCTATCCTTGGGGCTATTAACTTTATTACAACAATTCTTAATATGAAACCTCCTGCTATATCCCAATATCAAACCCCACTCTTCGTGTGGTCTGTTCTAATTACAGCTGTCCTGCTTCTTCTCTCCCTCCCTGTTCTTGCAGCCGGGATCACAATACTCCTTACGGACCGAAATCTTAATACGACTTTCTTTGACCCTGCAGGAGGGGGTGACCCTATTCTGTATCAACACCTATTCTGA