Caesio lunaris | University of the Philippines Mindanao | Marine Biodiversity Database Project
Caesio lunaris
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Vertebrata
  • Order » Perciformes
  • Family » Caesionidae
  • Genus » Caesio
  • Species » lunaris
  • Caesio lunaris
    (Lunar fusilier)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 50 m . Tropical; 31°N - 28°S, 32°E - 167°E

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm TL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 13 - 15; Anal spines: 3; Anal soft rays: 10 - 11. This species is distinguished by the following characters: a single postmaxillary process; D X, usually 14 soft rays; A III, usually 11soft rays; supratemporal band of scales generally interrupted at dorsal midline by a narrow scaleless zone; lateral line scales modally 49; scales above lateral line to dorsal -fin origin 7-10 (modally 8), below lateral line to anal-fin origin 14-19; predorsal scales 20-26; greatest body depth 2.2-3.1 in SL, head length 2.7-3.4 in SL; colour of body bluish, belly paler than upper sides; tips of caudal fin lobes, axil of pectoral fins, and upper base of pectoral fins black; caudal fin blue (except in juveniles where caudal fin and portions of caudal peduncle often yellow); pectoral, pelvic, and anal fins white to pale blue (pink or reddish after death); dorsal fin bluish ( Ref. 68703, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_028A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:06 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524271
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:14 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGCCTGCTCATTCGAGCGGAACTAAGCCAACCAGGAGCTCTTCTTGGAGACGATCAAATTTACAATGTAATTGTAACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTTGGAAACTGACTGATCCCCCTAATGATCGGGGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTTTGACTCCTTCCTCCATCATTCCTGCTCTTGCTCGCCTCCTCTGGAGTAGAAGCAGGGGCCGGAACTGGATGAACAGTTTATCCTCCACTAGCAGGGAACCTAGCACACGCGGGAGCATCTGTAGACCTAACTATTTTCTCCCTCCACCTGGCAGGTGTTTCCTCAATTCTAGGGGCCATTAACTTCATCACAACTATCATCAATATGAAACCCCCCGCTATTTCCCAATATCAAACACCACTATTTGTTTGAGCTGTCCTAATTACCGCCGTCCTCCTTCTTCTCTCCCTGCCAGTTTTAGCTGCCGGAATTACAATGCTTCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCAGCGGGAGGAGGGGATCCTATCCTCTACCAACACCTATCCTGA