Epinephelus lanceolatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus lanceolatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » lanceolatus
  • Epinephelus lanceolatus
    (Giant grouper)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 200 m , usually ? - 50 m . Tropical; 29°N - 39°S, 24°E - 122°W

    Maturity: Lm ?, range 129 - ? cm Max length : 270 cm TL male/unsexed; ; common length : 190 cm TL male/unsexed; ; max. published weight: 400.0 kg

    Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: robust body, its width 1.5-1.75 in body depth; body depth 2.3-3.4 in SL (for specimens 12-179 cm SL); head length 2.2-2.7 in SL; eye diameter 5.8-14 in HL; interorbital width 3.3 (at 177 cm SL) to 6.2 (at 12 cm SL) in HL; preopercle finely serrate, the corner rounded; upper edge of operculum convex; midlateral part of lower jaw with 2-3 rows of teeth (at 20-25 cm SL) increasing to 15-16 rows in specimen of 177 cm SL; canine teeth at front of jaws small or absent; pill rakers of first gill arch 8-10 + 14-17; dorsal fin third to eleventh spines subequal, shorter than longest soft rays; short pelvic fins, 23.0-2.7 in head length; caudal fin rounded; lateral-line scales 54-62, the anterior scales with branched tubules (except small juveniles). Colour: small juveniles (less than 15 cm) yellow, with 3 irregular black areas, the first from spinous dorsal fin to belly and chest and extending onto head, the second from base of soft dorsal fin to anal fin and the last at base of caudal fin; subadults (25-60 cm) with irregular white or yellow spots on the black areas and fins with black spots; adults (90-165 cm) dark brown with faint mottling, the fins with numerous small black spots; large adults 180-250 cm) dark brown, fins darker ( Ref. 39231, 89707, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2018_039A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Data deficient (DD); Date assessed:18 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524386
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:18 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGGGCTGGGATAGTAGGAACAGCCCTTAGTTTGCTAATTCGGGCTGAACTAAGCCAGCCAGGGGCTCTGCTAGGTGATGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATAATCGGTGGCTTTGGAAATTGACTCATCCCACTTATAATTGGTGCCCCTGACATAGCGTTCCCTCGGATGAATAACATGAGTTTCTGACTTCTCCCCCCTTCTTTCCTGCTTCTTCTTGCCTCCTCTGGAGTAGAAGCTGGTGCTGGCACTGGCTGAACGGTCTACCCACCCCTAGCCGGAAATCTAGCCCATGCAGGTGCATCTGTAGACTTAACTATCTTCTCACTACACTTGGCAGGGATTTCATCAATCCTAGGTGCAATTAACTTTATTACAACCATCATTAACATAAAACCCCCTGCCATCTCTCAATACCAAACACCTTTGTTCGTATGGGCTGTACTAATCACAGCAGTACTACTACTCCTCTCCCTCCCTGTCCTTGCCGCCGGCATCACTATGTTGCTTACTGATCGTAACCTTAACACTACCTTCTTTGATCCAGCCGGAGGAGGAGATCCAATTCTTTACCAGCACTTGTTCTGA