Epinephelus lanceolatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus lanceolatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » lanceolatus
  • Epinephelus lanceolatus
    (Giant grouper)
  • Description »   (Wikipedia) The giant grouper (Epinephelus lanceolatus), also known as the Queensland groper (grouper), brindle grouper or mottled-brown sea bass, is a species of marine ray-finned fish, a grouper from the subfamily Epinephelinae which is part of the family Serranidae, which also includes the anthias and sea basses. It has a wide Indo-Pacific distribution and is one of the largest extant species of bony fish.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_039A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524386
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:18 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGGGCTGGGATAGTAGGAACAGCCCTTAGTTTGCTAATTCGGGCTGAACTAAGCCAGCCAGGGGCTCTGCTAGGTGATGACCAGATTTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATCATAATCGGTGGCTTTGGAAATTGACTCATCCCACTTATAATTGGTGCCCCTGACATAGCGTTCCCTCGGATGAATAACATGAGTTTCTGACTTCTCCCCCCTTCTTTCCTGCTTCTTCTTGCCTCCTCTGGAGTAGAAGCTGGTGCTGGCACTGGCTGAACGGTCTACCCACCCCTAGCCGGAAATCTAGCCCATGCAGGTGCATCTGTAGACTTAACTATCTTCTCACTACACTTGGCAGGGATTTCATCAATCCTAGGTGCAATTAACTTTATTACAACCATCATTAACATAAAACCCCCTGCCATCTCTCAATACCAAACACCTTTGTTCGTATGGGCTGTACTAATCACAGCAGTACTACTACTCCTCTCCCTCCCTGTCCTTGCCGCCGGCATCACTATGTTGCTTACTGATCGTAACCTTAACACTACCTTCTTTGATCCAGCCGGAGGAGGAGATCCAATTCTTTACCAGCACTTGTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 23 visit(s) today - 304954 total visits (552 average daily visits): 2023-05-22 - 2024-11-24 (552 days)