Pomacanthus imperator | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pomacanthus imperator
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacanthidae
  • Genus » Pomacanthus
  • Species » imperator
  • Pomacanthus imperator
    (Emperor angelfish)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 1 - 100 m . Tropical; 31°N - 28°S, 32°E - 144°W

    Maturity: Lm 25.0  range ? - ? cm Max length : 40.0 cm SL male/unsexed; ; max. reported age: 14 years

    Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 17 - 21; Anal spines: 3; Anal soft rays: 18 - 21. Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2018_023A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:08 October 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524583
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:19 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTACTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCACTAAGCCTGCTGATTCGAGCCGAACTAAACCAACCAGGCAGTCTTCTCGGAGACGACCAGATCTATAATGTCATTGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTAATGCCAGCAATAATCGGAGGTTTTGGGAACTGGCTAGTTCCACTGATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAATAATATAAGCTTTTGACTCCTACCCCCTTCCCTCCTCCTTCTCCTTGCTTCCGCTGGAGTAGAAGCAGGAGCTGGGACCGGGTGAACAGTTTACCCACCCCTGGCCGGCAATCTAGCCCATGCAGGAGCATCCGTAGATTTGACCATTTTTTCTCTTCATCTGGCCGGGATCTCCTCAATTCTGGGGGCCATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCTATCTCACAGTACCAGACCCCCTTATTTGTATGAGCCGTCCTAATTACTGCGGTCCTACTTCTGCTCTCTCTTCCCGTCCTTGCTGCCGGCATCACAATGCTTCTCACGGACCGAAACCTAAACACCACCTTTTTTGACCCTGCAGGAGGGGGAGACCCAATCCTCTACCAACATTTATTCTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 257 visit(s) today - 599123 total visits (856 average daily visits): 2023-05-22 - 2025-04-21 (700 days)