Pomacanthus imperator | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pomacanthus imperator
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacanthidae
  • Genus » Pomacanthus
  • Species » imperator
  • Pomacanthus imperator
    (Emperor angelfish)
  • Description »   (Wikipedia) The emperor angelfish (Pomacanthus imperator) is a species of marine angelfish. It is a reef-associated fish, native to the Indian and Pacific Oceans, from the Red Sea to Hawaii and the Austral Islands. This species is generally associated with stable populations and faces no major threats of extinction. It is a favorite of photographers, artists, and aquarists because of its unique, brilliant pattern of coloration.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2018_023A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524583
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:19 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTACTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCACTAAGCCTGCTGATTCGAGCCGAACTAAACCAACCAGGCAGTCTTCTCGGAGACGACCAGATCTATAATGTCATTGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTAATGCCAGCAATAATCGGAGGTTTTGGGAACTGGCTAGTTCCACTGATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAATAATATAAGCTTTTGACTCCTACCCCCTTCCCTCCTCCTTCTCCTTGCTTCCGCTGGAGTAGAAGCAGGAGCTGGGACCGGGTGAACAGTTTACCCACCCCTGGCCGGCAATCTAGCCCATGCAGGAGCATCCGTAGATTTGACCATTTTTTCTCTTCATCTGGCCGGGATCTCCTCAATTCTGGGGGCCATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCTATCTCACAGTACCAGACCCCCTTATTTGTATGAGCCGTCCTAATTACTGCGGTCCTACTTCTGCTCTCTCTTCCCGTCCTTGCTGCCGGCATCACAATGCTTCTCACGGACCGAAACCTAAACACCACCTTTTTTGACCCTGCAGGAGGGGGAGACCCAATCCTCTACCAACATTTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1426 visit(s) today - 304912 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)