Parupeneus crassilabris | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus crassilabris
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » crassilabris
  • Parupeneus crassilabris
    (Two-banded goatfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 80 m . Tropical; 32°N - 28°S, 95°E - 173°W

    Maturity: Lm ?  range ? - ? cm Max length : 38.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. Diagnosis: Pectoral rays 15-16 (rarely 15). Gill rakers 7-10 + 27-31 (total 35-40). Body depth 2.653.1 in SL (deeper body with growth); head length (HL) 2.8-3.15 in SL; snout length 1.75-1.95 in HL; barbels short, 1.45-1.75 in HL; longest dorsal spine 1.4-1.6 in HL; penultimate dorsal ray 1.2-1.5 in length of last dorsal ray; pectoral-fin length 1.25-1.45 in HL; pelvic-fin length 1.2-1.4 in HL. Color white, the scale edges yellow or yellowish gray, the posterior edge often enlarged to a distinct yellow spot; upper two-thirds of body with two very large oval black spots, the first centered below anterior spines of first dorsal fin and the second below anterior half or more of second dorsal fin and extending into basal part of fin; a large black spot on head behind and enclosing part of eye, extending diffusely toward comer of mouth; broad outer part of second dorsal and anal fins blue with narrow oblique dark-edged yellow bands; caudal fin streaked with dull blue and yellow; inner rim of iris bright red . Body shape (shape guide): fusiform / normal.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2018_004A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524551
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:19 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTACCTAGTCTTCGGTGCCTGAGCCGGTATGGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCCGAGCTCAGCCAGCCCGGCGCTCTTCTAGGTGACGACCAAATTTACAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATGCCAATCATGATTGGAGGGTTTGGCAACTGACTAATCCCACTCATGATCGGTGCACCAGACATGGCCTTCCCTCGGATAAACAACATGAGCTTCTGGCTACTCCCCCCTTCTTTCCTCCTCCTACTTGCCTCTTCAGGCGTTGAAGCAGGAGCTGGAACTGGTTGAACAGTTTACCCCCCACTAGCGGGCAATCTGGCACACGCCGGAGCATCTGTTGACCTCACTATCTTCTCCCTCCACCTGGCAGGTATTTCTTCTATCTTGGGAGCTATTAATTTTATTACTACGATCATTAATATGAAACCTCCTGCAATTTCACAATACCAGACACCCCTGTTCGTTTGAGCTGTTCTAATTACAGCCGTTCTACTTCTTCTATCCCTTCCTGTACTTGCCGCTGGCATTACAATGCTACTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCGGCAGGAGGGGGAGACCCAATCCTTTATCAGCATCTATTCTGA