Abalistes filamentosus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Abalistes filamentosus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Tetraodontiformes
  • Family » Balistidae
  • Genus » Abalistes
  • Species » filamentosus
  • Abalistes filamentosus
    (Hairfin triggerfish)
  • Description »  

    Marine; pelagic-neritic; depth range 61 - 180 m . Subtropical

    Maturity: Lm ?  range ? - ? cm Max length : 32.5 cm SL male/unsexed; ; 24.3 cm SL (female); max. published weight: 1.4 kg

    Dorsal spines (total): 3; Dorsal soft rays (total): 25 - 27; Anal soft rays: 22 - 25. This species is distinguished by the following characters: D III,25-27; A 22-25; pectoral rays 14-15 (usually 14); body scale rows 33-39; head scale rows 25-32; upper and lower rays of the caudal fin are greatly produced in filaments; cheek with 3 or 4 longitudinal grooves. Colouration: proximal part of spinous dorsal fin is dark brown; body without yellow/pale blue spots or yellow reticulations; ground color of body is dark brown dorsally, mottled with irregular pale markings, then becoming white ventrally; cheek is brown with greenish tinge .

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_195A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 January 2022 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524226
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:19 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTACCTAATTTTTGGTGCTTGAGCTGGGATAGTAGGTACAGCCTTAAGCTTACTAATCCGAGCAGAATTAAGCCAACCCGGCGCTCTCTTAGGTGATGATCAAATTTATAATGTTATCGTCACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGATTAATCCCATTAATGATTGGAGCCCCTGATATAGCATTTCCCCGAATAAATAACATGAGCTTTTGACTTCTACCTCCCTCACTCCTTCTTCTGCTCGCTTCTTCAAGCGTAGAAGCCGGGGCTGGGACTGGATGAACAGTATATCCCCCTCTTGCCGGCAACCTAGCTCATGCAGGAGCTTCTGTAGACCTAACTATTTTCTCCCTCCACCTAGCGGGTATTTCATCAATTCTAGGGGCAATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCCATCTCCCAGTATCAGACACCGCTATTCGTCTGAGCAGTCCTAATTACAGCGGTTCTCCTTCTCCTATCCCTTCCTGTCCTAGCCGCCGGAATCACAATATTACTTACCGATCGAAATTTAAACACTACATTTTTTGACCCTGCTGGAGGTGGAGACCCAATCCTCTACCAACACTTATTCTGA