Cephalopholis aitha | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cephalopholis aitha
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Cephalopholis
  • Species » aitha
  • Cephalopholis aitha
    (Rusty hind)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 5 - 33 m . Tropical; 20°N - 12°S, 111°E - 149°E

    Maturity: Lm ?  range ? - ? cm Max length : 25.0 cm TL male/unsexed; ( Ref. ); common length : 20.0 cm TL male/unsexed; ( Ref. )

    Dorsal spines (total): 9; Dorsal soft rays (total): 14; Anal spines: 3; Anal soft rays: 8. Similar to the more common Cephalopholis spiloparaea but lacks banding in the caudal fin ; characterized further by reddish brown color; base of pelvic fins with indistinct dark blotch; greatest body depth 2.5-2.9 in SL; rounded caudal fin; short pelvic fins, 2.3-2.5 in head length; strongly bilobed margin of front of upper lip ; head length 2.1-2.3 times in SL; rounded preopercle, posterior edge finely serrate, lower edge fleshy; very convex upper edge of operculum; maxilla extends past eye; teeth large; midlateral-body scales ctenoid . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_126A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:18 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524291
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:19 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTAGGTACAGCTCTTAGCCTACTGATTCGAGCAGAACTAAGCCAACCGGGTGCCCTACTAGGCGATGATCAAATCTATAATGTGATTGTTACGGCACATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGGTTTGGAAACTGACTCATCCCACTAATAATTGGCGCTCCAGACATAGCCTTCCCCCGAATAAACAATATAAGCTTCTGATTACTTCCCCCATCCTTCCTACTCCTCCTAGCCTCATCTGGAGTAGAAGCTGGTGCCGGAACTGGTTGAACGGTGTACCCACCCCTAGCTGGAAATCTAGCCCACGCAGGTGCATCCGTTGACCTAACAATCTTTTCTTTACATTTAGCAGGTATTTCATCAATTCTGGGGGCAATCAATTTCATTACAACCATTATTAATATAAAACCTCCCGCTATTTCCCAATACCAAACACCTCTATTCGTCTGAGCTGTCCTAATTACAGCTGTCCTCCTCCTCCTGTCTCTTCCCGTTCTTGCCGCAGGCATTACAATGCTTCTAACAGATCGAAATCTTAATACCACATTCTTTGACCCAGCCGGTGGAGGAGACCCAATTCTCTACCAACACCTATGCTGA