Epinephelus corallicola | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus corallicola
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » corallicola
  • Epinephelus corallicola
    (Coral grouper)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 30 m . Tropical; 27°N - 30°S, 100°E - 155°E

    Maturity: Lm ?, range 29 - ? cm Max length : 49.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: greatest depth of body 2.9-3.2 in SL; ctenoid scales on body except cycloid scales anterodorsally and ventrally; body with auxiliary scales; gill rakers 8-10 + 14-17; pectoral-fin length 1.5-1.7 times in head length; rounded caudal fin; short pelvic fins, 1.8-2.3 in head length. Colour pale grey (sometimes with diffused white blotches) with small, widely spread black spots smaller than pupil on head, body and fins; 3 dusky to blackish blotches on body at base of rear half of dorsal fin, the largest at base of last 2-3 spines; dusky to blackish saddle spot on caudal peduncle; juveniles with black-edged white spots on head and body ( Ref. 39231, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_125A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:18 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524383
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:20 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGCATGGTAGGAACTGCCCTCAGCCTTCTTATTCGAGCCGAGCTTAGCCAACCAGGGGCTCTACTAGGTGACGATCAGATCTATAATGTGATTGTGACAGCACACGCTTTCGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGTGGCTTTGGAAACTGACTCATCCCACTAATAATTGGTGCTCCAGACATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTTCTCCCCCCATCTTTCCTGCTTCTTCTCGCTTCTTCTGGGGTAGAAGCCGGTGCTGGTACTGGCTGAACAGTCTATCCACCCCTAGCCGGAAACCTAGCCCATGCAGGTGCATCTGTAGACTTAACCATCTTTTCATTACACTTAGCAGGGATTTCATCAATTCTAGGTGCAATCAATTTTATTACAACCATTATTAACATGAAACCCCCGGCCATCTCTCAATACCAAACACCTTTATTTGTATGAGCTGTGCTAATTACAGCAGTGCTTCTGCTCCTCTCCCTTCCTGTTCTTGCCGCCGGCATTACAATACTACTCACAGACCGTAATCTCAATACCACTTTTTTCGACCCGGCCGGAGGGGGAGACCCAATTCTCTACCAACACTTATTCTGA