Plectropomus leopardus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectropomus leopardus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Plectropomus
  • Species » leopardus
  • Plectropomus leopardus
    (Leopard coralgrouper)
  • Description »   (Wikipedia) The leopard coral grouper (Plectropomus leopardus), also known as the common coral trout, leopard coral trout, blue-dotted coral grouper or spotted coral grouper, is a species of marine ray-finned fish, a grouper from the subfamily Epinephelinae which is part of the family Serranidae, which also includes the anthias and sea basses. It is found in the Western Pacific Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_124A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524579
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:20 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGGATAGTCGGGACCGCTCTAAGCCTACTTATTCGGGCGGAGCTTAGTCAACCCGGTGCTCTTTTAGGAGACGACCAAATCTATAACGTGATTGTTACCGCACACGCATTTGTAATAATCTTTTTTATAGTAATACCAATCATAATCGGAGGCTTCGGAAATTGACTTATTCCTCTAATAATCGGCGCCCCAGATATAGCATTCCCTCGAATAAACAATATAAGCTTCTGGCTTCTACCTCCTTCTTTCCTCCTCCTTCTAGCCTCATCAGGCGTTGAAGCAGGTGCTGGGACAGGATGAACAGTTTACCCTCCTCTAGCAGGAAACCTAGCCCATGCAGGTGCATCCGTAGATTTAACAATCTTCTCACTTCACTTAGCAGGTATTTCATCAATTCTTGGAGCAATCAACTTTATTACTACCATCATTAACATGAAACCCCCTGCTATCTCTCAATACCAGACCCCCCTATTCGTATGAGCAGTCCTAATTACTGCAGTTCTTCTTCTCCTATCACTACCTGTTCTAGCTGCTGGAATCACAATACTATTAACCGACCGAAACCTCAACACTACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATCCTCTACCAGCACTTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1427 visit(s) today - 304913 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)