Plectropomus leopardus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectropomus leopardus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Plectropomus
  • Species » leopardus
  • Plectropomus leopardus
    (Leopard coralgrouper)
  • Description »  

    Marine; reef-associated; depth range 3 - 100 m . Tropical; 24°C - ? ; 35°N - 30°S, 99°E - 178°W

    Maturity: Lm 37.3, range 21 - 60 cm Max length : 120 cm SL male/unsexed; ; common length : 35.0 cm SL male/unsexed; ( Ref. ); max. published weight: 23.6 kg ; max. reported age: 26 years

    Dorsal spines (total): 7 - 8; Dorsal soft rays (total): 10 - 12; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: D VIII,11; A III,8; pectoral rays 14-17 (modally 16); lateral line scales 89-99, in longitudinal series 112-127 scales; interorbital space no embedded scales; gill rakers on first gill arch developed 1-3 + 6-10; front of jaws with a pair of large canine teeth and side of lower jaw with 1-4 large canines; body elongate, its greatest depth 2.9-3.6 in SL; truncate to slightly emarginate caudal fin; pectoral fins 2.0-2.3 in HL; pelvic fins 2.0-2.4 in HL; Head, body and fins with numerous blue spots on red, pale grey or olive to dark brown background; caudal fin with a narrow white posterior margin except near the corners; juveniles (< 5 cm) brown on upper 2/3 of side with scattered blue spots, broad whitish stripe from eye to caudal fin base, white on lower head and yellowish ventrally on side ( Ref. 4787, 54980, 90102).
    Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_124A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:20 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524579
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:20 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGGATAGTCGGGACCGCTCTAAGCCTACTTATTCGGGCGGAGCTTAGTCAACCCGGTGCTCTTTTAGGAGACGACCAAATCTATAACGTGATTGTTACCGCACACGCATTTGTAATAATCTTTTTTATAGTAATACCAATCATAATCGGAGGCTTCGGAAATTGACTTATTCCTCTAATAATCGGCGCCCCAGATATAGCATTCCCTCGAATAAACAATATAAGCTTCTGGCTTCTACCTCCTTCTTTCCTCCTCCTTCTAGCCTCATCAGGCGTTGAAGCAGGTGCTGGGACAGGATGAACAGTTTACCCTCCTCTAGCAGGAAACCTAGCCCATGCAGGTGCATCCGTAGATTTAACAATCTTCTCACTTCACTTAGCAGGTATTTCATCAATTCTTGGAGCAATCAACTTTATTACTACCATCATTAACATGAAACCCCCTGCTATCTCTCAATACCAGACCCCCCTATTCGTATGAGCAGTCCTAATTACTGCAGTTCTTCTTCTCCTATCACTACCTGTTCTAGCTGCTGGAATCACAATACTATTAACCGACCGAAACCTCAACACTACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATCCTCTACCAGCACTTATTCTGA