Branchiostegus saitoi | University of the Philippines Mindanao | Marine Biodiversity Database Project
Branchiostegus saitoi
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Malacanthidae
  • Genus » Branchiostegus
  • Species » Saitoi
  • Branchiostegus saitoi
    (Deepwater tilefish)
  • Description »  

    Marine; benthopelagic; depth range 210 - 220 m . Tropical; 14°N - 13°N, 121°E - 122°E

    Maturity: Lm ?  range ? - ? cm Max length : 32.9 cm SL male/unsexed;

    Dorsal spines (total): 7; Dorsal soft rays (total): 15; Anal spines: 2; Anal soft rays: 12; Vertebrae: 24. This species is distinguished from its congeners by the following set of characters: great body depth (28-29% SL; vs. the usual 27% SL); longer head length 30-31% SL (vs. usual 28%),: head profile oblique, about 130 degree angle (vs. usual 95-130 degrees); head depth 26-27% SL (vs. usual 26% SL); eyes high on head, interorbital width 31-34% HL; small orbital diameter 24–25% HL, only B. sawakinensis and B. albus with small orbital diameters, 23-24% HL) long predorsal length 35% SL (vs. usual 30-32% SL, rarely 33-34% SL), deep body 28-29% SL (vs. usual 24-27%, rarely, only in B. japonicus and B. semifasciatus, 28-29% SL); wide body 14-15% SL (vs. usual 11-13% SL); number of first arch gill rakers low 18 + 1 rudimentary (vs. most other species 18-24, modally 19-22) . Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_077A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Data deficient (DD); Date assessed:01 March 2017 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524267
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:20 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGTATAGTAGGCACAGCCTTAAGCTTGCTCATTCGAGCAGAACTTAGCCAACCAGGCGCCCTCCTCGGGGATGACCAGATTTACAATGTTATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGCAACTGACTAATTCCCCTTATAATTGGCGCCCCCGATATAGCCTTCCCCCGCATAAACAACATGAGCTTTTGACTTCTCCCCCCCTCATTCCTACTACTACTTGCCTCCTCTGGCGTGGAGGCAGGAGCAGGGACCGGCTGGACAGTATATCCCCCTTTAGCTGGCAACCTCGCCCACGCAGGACCCTCCGTTGATCTAACAATTTTTTCCCTCCATCTGGCAGGAGTGTCTTCAATCCTTGGCGCCATTAACTTTATTACTACCATTATTAACATAAAACCTCCCGCCACAACACAATATCAAACCCCCTTATTTGTCTGATCTGTATTGATTACCGCTGTCCTTCTCCTCCTATCTCTGCCAGTCCTTGCTGCTGGCATCACAATACTTCTCACAGACCGAAACCTAAATACTACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTCTACCAACACCTCTTTTGA