Plectorhinchus vittatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectorhinchus vittatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Plectorhinchus
  • Species » Vittatus
  • Plectorhinchus vittatus
    (Indian ocean oriental sweetlips)
  • Description »  

    Marine; reef-associated; depth range 2 - 25 m . Tropical; 30°N - 27°S, 32°E - 167°W

    Maturity: Lm ?  range ? - ? cm Max length : 72.0 cm SL male/unsexed;

    Dorsal spines (total): 12 - 14; Dorsal soft rays (total): 17 - 20; Anal spines: 3; Anal soft rays: 7 - 8. This species is distinguished by the following characters: chin with 6 pores, no median pit; gill rakers on first gill arch 9-11 + 1 + 20-23 = 29-34; Dorsal fin with XII-XIV (usually XIII),17-20 with 3rd or 4th spines longest; lips fleshy, greatly swollen with age; scales ctenoid (rough to touch); lateral line tubed scales about 55-65; body depth 2.6-2.9 in SL; caudal fin rounded in juveniles, truncate in adults. Colour: juveniles with connected black blotches and spots that gradually break up into horizontal stripes; pectoral fins black in juveniles becoming uniform yellow in adults; tail spotted with age; adults with 6 to 12 broad dark brown, blue-brown or black stripes that persist on the belly and join horizontally across the nape and snout with anterior part of pale interspaces yellow forming 2 bright yellow stripes across interorbital and 2 around snout; eye usually yellow; fins yellow with black margins to vertical fins and black spots, pectoral fins uniform yellow with red-brown, chocolate, or blackish base, pelvic fins yellow with base red-brown, scarlet, or dark brown ( Ref. 47695, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market] [Mati City, Davao Oriental] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_064AB] [FDP_MATI_2202_002A] [FDP_IGCS_2202_044A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:28 June 2018 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524574
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:05 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTGGGGACGGCCTTAAGCCTGCTCATCCGAGCAGAATTAAGCCAACCCGGCGCTCTCCTAGGAGACGACCAGATTTACAATGTAATTGTTACGGCACATGCGTTCGTAATAATCTTTTTTATGGTAATACCAATCCTAATTGGAGGGTTTGGAAACTGACTGGTCCCACTAATGATTGGAGCACCTGACATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTCCTCCTCCTTGCCTCCTCAGGCGTAGAAGCCGGGGCGGGAACTGGCTGAACAGTCTATCCCCCATTAGCCGGTAATTTGGCACACGCAGGGGCATCCGTCGACCTAACAATCTTCTCTCTTCATCTAGCCGGTATTTCATCAATTCTTGGGGCAATCAATTTTATTACAACAATCATTAACATGAAACCCCCTGCAATTTCGCAATACCAGACCCCCCTGTTCGTCTGATCGGTCCTAGTAACCGCTGTCCTCCTTCTCCTTTCCCTTCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGATCGAAACCTCAACACTACTTTCTTCGACCCGGCAGGGGGAGGAGACCCAATTCTCTACCAACACCTATTCTGA