Plectorhinchus vittatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectorhinchus vittatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Plectorhinchus
  • Species » Vittatus
  • Plectorhinchus vittatus
    (Indian ocean oriental sweetlips)
  • Description »   (Wikipedia) The Indian Ocean oriental sweetlips (Plectorhinchus vittatus), also known as the oriental sweetlips or oriental blubberlips, is a species of marine ray-finned fish, a sweetlips belonging to the subfamily Plectorhinchinae, one of two subfamilies in the family Haemulidae, the grunts. It is native to the Indian Ocean and the western Pacific Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market] [Mati City, Davao Oriental] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_064AB
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524574
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 2:18 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTGGGGACGGCCTTAAGCCTGCTCATCCGAGCAGAATTAAGCCAACCCGGCGCTCTCCTAGGAGACGACCAGATTTACAATGTAATTGTTACGGCACATGCGTTCGTAATAATCTTTTTTATGGTAATACCAATCCTAATTGGAGGGTTTGGAAACTGACTGGTCCCACTAATGATTGGAGCACCTGACATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTCCTCCTCCTTGCCTCCTCAGGCGTAGAAGCCGGGGCGGGAACTGGCTGAACAGTCTATCCCCCATTAGCCGGTAATTTGGCACACGCAGGGGCATCCGTCGACCTAACAATCTTCTCTCTTCATCTAGCCGGTATTTCATCAATTCTTGGGGCAATCAATTTTATTACAACAATCATTAACATGAAACCCCCTGCAATTTCGCAATACCAGACCCCCCTGTTCGTCTGATCGGTCCTAGTAACCGCTGTCCTCCTTCTCCTTTCCCTTCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGATCGAAACCTCAACACTACTTTCTTCGACCCGGCAGGGGGAGGAGACCCAATTCTCTACCAACACCTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1375 visit(s) today - 304861 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)