Stethojulis strigiventer | University of the Philippines Mindanao | Marine Biodiversity Database Project
Stethojulis strigiventer
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Stethojulis
  • Species » Strigiventer
  • Stethojulis strigiventer
  • Description »   (Wikipedia) Stethojulis strigiventer, also known as the three-ribbon wrasse, silverstreak wrasse, silverbelly wrasse, lined rainbowfish or silver-streaked rainbowfish, is a species of marine ray-finned fish, a wrasse from the family Labridae. This species occurs in beds of seagrass and areas of inner reefs and shallow lagoons where there is a substrate consisting of mixed sand, rubble, and algae. It is found in small groups which swim over large areas down as deep as 20 metres (66 ft). The range of this species extends from the Red Sea southwards along the eastern coast of Africa to Algoa Bay in KwaZulu-Natal, South Africa and eastwards to the Marshall and Tuamotu islands, it also extends north to Honshu and south to New South Wales. This species was first formally described as Julis strigiventer in 1833 by the English zoologist Edward Turner Bennett (1797-1836) with the type locality given as Mauritius. When Albert Günther created the genus Stethojulis he designated Julis strigiventer as the type species.
    Full article at Wikipedia
  • Local Name »   Three-ribbon wrasse
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_021A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524686
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:21 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTATACTTAGTTTTTGGTGCTTGAGCTGGAATGGTCGGCACAGCCCTAAGTCTACTTATTCGAGCCGAACTTAGTCAGCCAGGGGCTCTCCTAGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGGCTCATCCCACTAATAATCGGGGCACCCGACATGGCTTTCCCTCGAATAAACAATATGAGTTTTTGACTTCTCCCACCGTCGTTCCTTCTTCTACTTGCCTCTTCTGGTGTAGAAGCAGGGGCCGGTACCGGGTGAACAGTTTACCCCCCTCTAGCAGGAAATTTAGCTCATGCCGGTGCATCCGTGGACCTAACTATCTTTTCACTACACTTAGCAGGGGTTTCCTCAATCCTAGGAGCAATTAATTTTATTACAACCATTATCAACATAAAACCGCCTGCGATTTCTCAATATCAAACACCCCTATTTGTGTGAGCAGTCCTTATCACAGCAGTCCTTCTTCTTCTGTCCCTGCCCGTCCTCGCTGCCGGAATTACAATGCTTTTAACAGACCGAAACCTAAATACCACCTTCTTTGACCCTGCCGGAGGGGGAGATCCCATTCTTTATCAACACTTATTTTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1272 visit(s) today - 303369 total visits (552 average daily visits): 2023-05-22 - 2024-11-22 (550 days)