Anampses meleagrides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Anampses meleagrides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Anampses
  • Species » Meleagrides
  • Anampses meleagrides
    (Spotted wrasse)
  • Description »   (Wikipedia) The spotted wrasse, Anampses meleagrides, is a species of wrasse native to the Indian Ocean from the Red Sea and East Africa to the western Pacific Ocean to Samoa and the Tuamoto Islands and north to Japan. This species is found on coral reefs at depths of 3 to 60 m (9.8 to 196.9 ft). It can reach a length of 22 cm (8.7 in). It is of minor importance to local commercial fisheries and can be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_018A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524248
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:21 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATTTAGTATTCGGCGCCTGAGCCGGGATGGTAGGCACAGCCTTAAGCTTACTCATTCGAGCTGAGCTGAGCCAACCCGGCGCTCTCCTTGGAGACGACCAAATTTACAATGTTATCGTTACAGCTCATGCATTCGTTATAATCTTCTTTATAGTAATGCCAATTATAATCGGGGGATTCGGGAATTGACTCATTCCGCTGATAATCGGGGCGCCCGATATAGCCTTTCCTCGAATGAACAATATGAGCTTTTGACTTCTACCCCCATCTTTCTTACTTCTTCTTGCCTCTTCTGGTGTAGAGGCTGGAGCCGGGACTGGTTGAACAGTCTATCCCCCTTTAGCGGGAAACCTCGCCCATGCAGGTGCATCTGTTGATCTTACCATCTTTTCCCTACATTTAGCTGGTATCTCCTCAATCCTGGGTGCAATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCCATCTCCCAATACCAAACACCTCTCTTCGTCTGAGCCGTGTTAATTACAGCAGTACTTCTTCTTCTCTCCCTACCCGTTCTAGCAGCTGGAATCACAATGCTTCTTACAGACCGAAATCTAAATACCACCTTCTTCGATCCTGCTGGAGGTGGAGATCCCATTCTCTACCAACACCTCTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1317 visit(s) today - 303414 total visits (552 average daily visits): 2023-05-22 - 2024-11-22 (550 days)