Anampses meleagrides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Anampses meleagrides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Anampses
  • Species » Meleagrides
  • Anampses meleagrides
    (Spotted wrasse)
  • Description »  

    Marine; reef-associated; depth range 3 - 60 m , usually 5 - 50 m . Tropical; 24°C - 28°C ; 32°N - 35°S, 24°E - 132°W

    Maturity: Lm ?  range ? - ? cm Max length : 22.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 11 - 13; Anal spines: 3; Anal soft rays: 11 - 13. Ground color of female very dark brown; orangish on front of head and lower parts; body spotted with white or very pale yellow, extending to dorsal and anal fins; caudal bright cadmium. Male form deep violet; irregular blue spots on cheeks and lower operculum; body with round blue spots becoming oblong, nearly forming longitudinal bands ventrally; dorsal and anal fins with longitudinal bands; caudal with numerous blue ocelli. Dorsal spines flexible. Caudal fin of adults truncate to emarginate; rounded in small juveniles. Easily confused with male A. geographicus when seen underwater, except when displaying with iridescent blue-green lines and spots over the body and fins . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_018A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524248
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:21 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATTTAGTATTCGGCGCCTGAGCCGGGATGGTAGGCACAGCCTTAAGCTTACTCATTCGAGCTGAGCTGAGCCAACCCGGCGCTCTCCTTGGAGACGACCAAATTTACAATGTTATCGTTACAGCTCATGCATTCGTTATAATCTTCTTTATAGTAATGCCAATTATAATCGGGGGATTCGGGAATTGACTCATTCCGCTGATAATCGGGGCGCCCGATATAGCCTTTCCTCGAATGAACAATATGAGCTTTTGACTTCTACCCCCATCTTTCTTACTTCTTCTTGCCTCTTCTGGTGTAGAGGCTGGAGCCGGGACTGGTTGAACAGTCTATCCCCCTTTAGCGGGAAACCTCGCCCATGCAGGTGCATCTGTTGATCTTACCATCTTTTCCCTACATTTAGCTGGTATCTCCTCAATCCTGGGTGCAATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCCATCTCCCAATACCAAACACCTCTCTTCGTCTGAGCCGTGTTAATTACAGCAGTACTTCTTCTTCTCTCCCTACCCGTTCTAGCAGCTGGAATCACAATGCTTCTTACAGACCGAAATCTAAATACCACCTTCTTCGATCCTGCTGGAGGTGGAGATCCCATTCTCTACCAACACCTCTTCTGA