Conger cinereus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Conger cinereus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Anguilliformes
  • Family » Congridae
  • Genus » Conger
  • Species » cinereus
  • Conger cinereus
    (Longfin African conger)
  • Description »   (Wikipedia) The longfin African conger (Conger cinereus) or blacklip conger, is an eel of the family Congridae, found in the Indo-Pacific oceans from the Red Sea and East Africa to the Marquesas and Easter islands, north to southern Japan and the Ogasawara Islands, south to northern Australia and Lord Howe Island, at depths down to 80 m. Length is up to 1.3 m.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_048A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:16 August 2011 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524347
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:19 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAATTTTTGGTGCTTGGGCCGGAATGGTAGGAACCGCCTTGAGCCTATTAATTCGAGCCGAACTAAGTCAACCTGGTGCACTTCTTGGAGATGACCAGATCTATAATGTAATCGTTACAGCACATGCTTTTGTAATAATCTTCTTTATGGTAATACCAGTAATAATTGGGGGATTTGGTAACTGACTTGTACCTTTAATAATTGGGGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGCTTCTGATTATTACCACCTTCTTTTCTTCTTTTATTAACTTCTTCTGGGGTTGAGGCTGGGGCCGGAACTGGATGAACTGTTTATCCCCCACTGGCCGGAAATTTAGCCCATGCAGGAGCCTCTGTTGACCTAACAATCTTTTCTCTTCATCTAGCAGGAATTTCATCAATCTTAGGGGCCATTAATTTTATTACTACAATTATTAATATAAAACCACCAGCCACCACTCAGTATCAAACTCCTTTATTTGTATGAGCAGTTCTTGTTACAGCTGTACTACTACTACTATCTCTTCCAGTATTAGCAGCCGGAATTACGATGCTATTAACAGACCGAAACCTTAATACTACATTCTTTGACCCAGCTGGAGGGGGGGACCCAATTCTCTATCAACACTTATTCTGA