Pseudodax moluccanus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pseudodax moluccanus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Pseudodax
  • Species » Moluccanus
  • Pseudodax moluccanus
    (Chiseltooth wrasse)
  • Description »   (Wikipedia) The chiseltooth wrasse (Pseudodax moluccanus) is a species of marine ray-finned fish, a wrasse from the family Labridae. It is native to the Indian Ocean and the western Pacific Ocean. It is an inhabitant of coral reefs and can be found at depths from 3 to 60 m (10 to 200 ft), though rarely deeper than 40 m (130 ft). This species grows to 30 cm (12 in) in total length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade. P. moluccanus is the only known member of its genus.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_013A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524602
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:22 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTACCTAGTTTTTGGTGCTTGAGCCGGCATAGTTGGGACAGCCCTAAGCCTACTTATTCGGGCGGAGCTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTAATCGTTACCGCACACGCGTTTGTGATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTCGGGAACTGACTTATCCCTTTAATGATTGGAGCGCCTGACATGGCTTTCCCTCGAATGAATAACATAAGCTTCTGACTCCTCCCCCCCTCATTCCTGCTTCTCCTTGCCTCTTCAGGGGTCGAAGCCGGGGCCGGGACTGGATGGACAGTATACCCCCCACTAGCAGGGAATCTAGCTCACGCTGGTGCTTCCGTTGACCTAACTATCTTCTCCCTCCACCTGGCAGGTATTTCGTCCATCCTAGGAGCAATCAACTTCATTACAACCATTATTAATATGAAACCTCCTGCTATTTCTCAGTACCAGACACCTTTATTTGTCTGAGCTGTTTTGATCACGGCCGTCCTTCTTCTCCTCTCGCTACCAGTTCTGGCTGCTGGCATCACGATGCTTCTAACAGACCGTAATCTCAATACCACATTCTTCGACCCTGCCGGAGGGGGGGACCCTATTCTGTATCAACACTTATTTTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1162 visit(s) today - 304648 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)