Thalassoma trilobatum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Thalassoma trilobatum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Thalassoma
  • Species » Trilobatum
  • Thalassoma trilobatum
    (Christmas wrasse)
  • Description »  

    Marine; reef-associated; depth range 0 - 10 m . Tropical; 30°N - 28°S

    Maturity: Lm ?  range ? - ? cm Max length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 13; Anal spines: 3; Anal soft rays: 11. This species is distinguished by the following characters: greatest body depth 2.7-3.6 in SL; pectoral fin rays usually 16; lateral line scales 25; total gill rakers on first gill arch 17-24 (modally 20); caudal fin of initial phase slightly rounded to truncate, of terminal males truncate to slightly double emaginate; Body of initial (female) phase greenish grey to pale green with 5-6 dark saddles on back, pair of dark (sometimes diffused) stripes on side, a dark vertical line on most scales of body, and with a diagonal (or C-shaped) pink to dark red below front of eye; while body of terminal male salmon-pink to orange anteriorly, with 2 longitudinal series of vertical green rectangles, every fourth pair of upper series extending as a single green bar across back, the head orange-brown without bands and caudal fin brownish to greenish, shading distally to pink, the posterior third of rays blue ( Ref. 9823, 86689, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_2017_008A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:07 March 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524702
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:22 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACTCTCTACCTTGTATTCGGCGCATGAGCTGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTGAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTAATGATTGGGGCCCCCGATATGGCCTTCCCTCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTCCTCCTTCTCGCTTCTTCTGGCGTTGAAGCGGGGGCCGGAACTGGATGAACAGTTTACCCGCCGCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGACCTCACTATCTTCTCCTTACATCTAGCGGGCATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCGTCTCTCAATATCAGACGCCTCTTTTCGTGTGAGCCGTTCTGATCACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCTGGAGGAGGGGACCCCATTCTTTATCAACATCTGTTCTGA