Thalassoma trilobatum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Thalassoma trilobatum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Thalassoma
  • Species » Trilobatum
  • Thalassoma trilobatum
    (Christmas wrasse)
  • Description »   (Wikipedia) The Christmas wrasse (Thalassoma trilobatum), also known as the ladder wrasse, green-barred wrasse or green-blocked wrasse, is a species of ray-finned fish, a wrasse from the family Labridae which is native to the Indian Ocean and the western Pacific Ocean. It inhabits shallow reefs at depths from the surface to 10 m (33 ft). It is of minor importance to local commercial fisheries and can be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_008A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524702
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:22 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACTCTCTACCTTGTATTCGGCGCATGAGCTGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTGAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTAATGATTGGGGCCCCCGATATGGCCTTCCCTCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTCCTCCTTCTCGCTTCTTCTGGCGTTGAAGCGGGGGCCGGAACTGGATGAACAGTTTACCCGCCGCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGACCTCACTATCTTCTCCTTACATCTAGCGGGCATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCGTCTCTCAATATCAGACGCCTCTTTTCGTGTGAGCCGTTCTGATCACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCTGGAGGAGGGGACCCCATTCTTTATCAACATCTGTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 187 visit(s) today - 171251 total visits (345 average daily visits): 2023-05-22 - 2024-09-29 (496 days)