Lutjanus johnii | | Marine Biodiversity Database Project
Lutjanus johnii
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Lutjanus
  • Species » johnii
  • Lutjanus johnii
  • Description »  

    Marine; brackish; reef-associated; oceanodromous ; depth range 0 - 80 m . Tropical; 31°N - 30°S, 30°E - 174°W

    Maturity: Lm 51.9  range ? - ? cm Max length : 106 cm TL male/unsexed; ; common length : 50.0 cm TL male/unsexed; ; max. published weight: 28.5 kg

    Dorsal spines (total): 10; Dorsal soft rays (total): 13 - 14; Anal spines: 3; Anal soft rays: 8. Dorsal profile of head steeply sloped. Preorbital width equal to eye diameter or larger. Preopercular notch and knob poorly developed. Scale rows on back parallel to lateral line. Center of each scale often with a reddish-brown spot, giving an overall appearance of series of horizontal lines on side of body. Generally yellow with a bronze to silvery sheen, shading to silvery white on belly and underside of the head. A large black blotch mainly above the lateral line below the anterior dorsal-fin rays. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »  
  • Collection Code »   [DNSC_2016_001A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524474
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 1:23 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGTACAGCCCTAAGCCTGCTCATTCGAGCAGAACTCAGCCAACCAGGAGCTCTTCTTGGAGACGACCAGATTTACAATGTTATTGTTACAGCGCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGCGGGTTTGGAAACTGGCTAGTACCCTTAATAATTGGGGCCCCAGACATAGCATTCCCCCGAATAAATAATATGAGCTTTTGACTCCTTCCCCCATCATTCCTGCTACTCCTGGCTTCCTCAGGCGTAGAGGCTGGTGCCGGAACCGGATGAACAGTTTACCCTCCCCTAGCAGGAAACCTAGCACATGCAGGAGCATCTGTTGACCTAACTATCTTTTCCCTCCATCTAGCAGGTGTTTCTTCAATTCTAGGGGCCATCAATTTTATTACAACAATTATTAATATAAAACCCCCTGCCATCTCTCAATATCAAACACCCCTATTTGTTTGAGCCGTCCTAATCACCGCTGTTCTGCTCCTCCTATCCCTCCCTGTCCTGGCTGCCGGAATCACAATACTTCTTACAGATCGAAATCTTAATACCACCTTCTTTGACCCAGCAGGCGGAGGAGACCCCATCCTCTATCAACACCTGTTCTGA