Anampses caeruleopunctatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Anampses caeruleopunctatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Anampses
  • Species » Caeruleopunctatus
  • Anampses caeruleopunctatus
    (Bluespotted wrasse)
  • Description »   (Wikipedia) The blue-spotted wrasse (Anampses caeruleopunctatus) is a species of wrasse found from the Atlantic coast of South Africa through the Indian Ocean to Japan and Australia east to Easter Island in the Pacific Ocean (though absent from Hawaii). This species is found at depths from 3 to 30 m (9.8 to 98.4 ft), with the adults preferring the surge zone on coral reefs or along rocky coastlines. Juveniles orient their bodies and move in such a way as to resemble floating leaves. This species can reach a length of 42 cm (17 in). It is of minor importance to local commercial fisheries and can be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   DNSC_2017_002A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524246
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 10:25 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATTTAGTATTCGGCGCCTGAGCCGGAATGGTGGGTACAGCCCTAAGCTTACTAATCCGAGCTGAACTGAGCCAACCCGGCGCTCTCCTTGGGGACGACCAAATTTACAATGTAATCGTTACAGCCCATGCGTTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGATTTGGCAACTGACTTATTCCCTTAATGATTGGAGCACCTGACATAGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTCTTACCTCCATCTTTCCTTCTTCTTCTTGCCTCTTCTGGTGTAGAAGCCGGAGCCGGAACCGGTTGAACAGTTTACCCCCCTCTAGCAGGAAACCTCGCCCATGCAGGCGCGTCTGTCGACCTAACGATCTTTTCTCTACATCTAGCTGGTATTTCTTCAATTTTAGGTGCTATCAACTTTATTACAACTATTATTAACATGAAACCTCCCGCTATCTCACAATACCAAACCCCTCTCTTCGTTTGAGCTGTATTAATTACAGCAGTACTCCTCCTCCTCTCCCTACCCGTTCTTGCAGCCGGGATTACAATACTCCTTACAGACCGAAACCTAAACACCACTTTCTTTGATCCTGCTGGAGGTGGGGACCCCATTCTTTATCAACATCTCTTTTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1077 visit(s) today - 306888 total visits (555 average daily visits): 2023-05-22 - 2024-11-25 (553 days)